background pandemonium a ?

How, when reading this text – even these very words – can it come effortless to read these words in the background? A background that, unlike a fair few others, a bias mind reads and yet requires to remain precisely HOW it lives? A living background? A background-organism? A background that requires no foreground? How can such a life or a being an object or a process come in our universe?
After-all
that which is near me, you and them – may have a background in term of space. That kind of near/far is very clear and basic. In fact possibly where the term background comes into life from.
However
it seems backgrounds can have more plasticity and indeed – sophisticated complexities? When we humans, and possibly other animals, focus on an image – that which we don’t zoom our attention on, becomes a background.
That background in space can alter in time – we can have our attention focused into zooming onto other, for example, objects in a room. Periodically making one element at the background, visual or cultural context of another? Altering between attention-zooms that change what the background is – despite static space conditions.
For example
A computer screen may come to be a focus, a foreground, to a naked wall. The naked wall’s nudity could come to attention and become an attention foreground to the screen. Perhaps at times when we, or some other animal, becomes tired of a computer screen?
Personally
I have a life beyond a window to focus at when the focus requires a bit of refreshing from the screen. However, the change is not just background/foreground – fuzzy attention and a focused zoom. Visually, the difference comes also from the other kind of light, colours and materialities of engagement with. The window’s outwardness offers, for example, a softer set of sensations than the digital screen production.
Reading
this, it might come notice-able that this text is likely to come on a screen. Focusing attention into this screen, and onto the implementations of involved technologies – I think humans, bots, spiders and other AIs come often with a question of background’s seeming disappearance. When an AI has to be attentive to each bit of information, a bit like when a human feels they have to make sure nothing on their social feed goes amiss – we get a certain flatness. When everything lives in the foreground, where and how are the spaces – the intervals – between things?
Superflat?
We have superflat. Is this another view of superflatness? There are some elements of superflat which connect to a lack of conceptual as well as visual depth – a missing that in itself offers a depth since its’ at the background of superflatness. So in that manner, perhaps the very considering of need for backgrounds has a superflat way by creating a background through the very witnessing of flatness?
Perhaps
though we have a different question when attention-culture comes to flatten sensations. Since we talk of different dimensions, since attention is under a calling from various materialities, multiple mediums that are inter-connected and cross intelligences – perhaps we get a hyper-flatness? Do we live in hyper-flat times that yearn for a background? Hyper-flat from web spiders for whom all data is relevant, from algorithms for whom a background to humans quirries doesn’t exist, from devices that need human and software attention at any given time, from information that demands human attention all the time, and from intersections between these elements that weave a network of flatness made of multiple manners and materialiess?
Games
on computers offer a different approach to visual background.
How?
Computer games tend to generate backgrounds relative to distance from where a player comes in a virtual space. Something far may look like a line in the horizon. Moving towards that line will generate other background details like mountains, forests, houses and so on. In some ways, we can say that this is another aspect of hyper-flatness. We can say that the lack of dynamism in the background’s visualisation offers something very flat. ie we can not have any visual indication of. for example, focusing our gaze onto the horizon – as a human may in other environments. However, perhaps we can say that the generative process, in and of itself, offers a background. A constant background that comes to life only as a background?
Yet
these questions come from a visual dimension and we began here from text. From reading… However, with the game example, we also have a reading of text. The program reads. The flicking of on/off switches – and soon to be both simultaneously –
comes via reading instructions. The visuals we get on screens, anything seen in screens, comes through some kind of reading texts – many times fairly comprehensible english – is that text flat? Does tech oriented text have it’s own background that lives as a behind-focus at all times?
Why
consider a certain background reading that comes always as a background? Why not like our attention in times of
pendemonia
let
the background rove in and out of focus? We could, afterall, go for a single voice pandemoniial-text.
Here’s an offer for
anyone we may fancy
to take on a mind
in their own hands
and allow simultaneous single
noise to come on
onto disregarding disregardedness of
another and some other
yet to come ignored
by attention moving on
or
speak your mind in various lives’ voices manners styles etc. at once when
prose chases readers off the text and into it’s background meanings
quickly –
what did it mean?
why is this word here?
A word?
No – you have to say. words never come
alone
never flat these textures on texts and words
are they not?
just sounds, noises from a reality that’s meaningless
and then the background comes bare like a naked wall?
meaningless
so these words and texts are full of backgrounds made of
meanings, noises, and idle aimlessness.
aimless idlility?
yes – when meanings have certain aims, the screen in front of you is a word that terms something different entirely to, for example, the screen that opened a theatrical show. and the naked wall’s nudity aims at something very different than your bare body’s mirrored reflections.
We aim from back to front in a space.
Yet
the meaning comes aimless since the sounds are simply space filling vibrations.
and
yet from this very text we can have a background that may inject spirit into a readers’ aimless move into thoughts away
from this very texts’ words?
Yes.
However can it work the same for a flower?
A flower?
A flower in a wind?
A wind?
A dark scented sunny wind.
A flower in a sunny dark scented wind?
A program that may make a windy scented dark sunny flower.
A program?
Yes. Like an app.
An app?
Yes on a digital device.
A device made of digit oriented technologies?
Yes. like the ones used to read very quickly appearing message streams.
Very quick that’s hard to read?
Very quick that’s not quick enough for the app to read. Apps could complain humans are too slow and waste their time.
Apps can complain?
Here’s the deal, an offering attempt rather than a complaining speculation.
A background made of text that has a time of pandemonia built into it.
A pandemonia time?
A built-in time?
A faster than a bullet time?
When there’s a / (slash) between terms, they should be read at the same time. like chords in music, play A G and B7 at the same time.
Boom?
Bum/Blind/Ping/Move/Play/Drone/Dude/Gun/Boon/Lush/Ground
read at the same time?
yes. try:

Bum/Blind/Ping/Move/Play/Drone/Dude/Gun/Boon/Lush/Ground

What?!?!
It’s impossible to read at the same time of course. Impossible when
attempting to read with a mind biased towards attempting to grasp
meanings
aims
thoughts made at the background by the whoever typed these terms.
however, there are other ways. other manners that are specifically oriented towards backgroundisation of text reading.
Lets for now
remain with:
Bum/Blind/Ping/Move/Play/Drone/Dude/Gun/Boon/Lush/Ground

just look and let yourself un-notice the words.
just look and allow yourself to use the un-noticing of these words, to take into some other possible kinds of noticing?
just look and allow yourself to use the un-noticing of these words, to take into some other possible kinds of thoughts?
kinds of thoughts.
Kinds of associations.
Once doing that, I think we may experience a certain wall hitting.
Wall hitting?
A certain difficulty, a problem, a false promise, a limitation.
I think we will find that doing, at the same time kinda background text reading such as:
Bum/Blind/Ping/Move/Play/Drone/Dude/Gun/Boon/Lush/Ground
will offer an array of associations
free associations
associations that come with no cost, no judgement, and indeed – no feedback but the same kind repeating.
One may do a
Bum/Blind/Ping/Move/Play/Drone/Dude/Gun/Boon/Lush/Ground
and leap from it into questions of
environment, trade, internet and coffee
as much as someone else may consider stuff like
surfing, sand, photography, sunsets and fun.
Therefore, unless we attach a penalty to certain range of coming-from such sequences, the associations may simply depend upon individuals and have a bit of a difficulty differencing one from another?
Yes.
Possibly a bit like another kind of a background reading.. Something like:
;kjbsf n ‘,kjsf sfdkhf fvf’fknknj d/;mhgsdf f
;jhjgfdfsd.mjbfkj /kjhfd jhkhkhkhkhkhdkhjidk jhsd jhfj
jdi ih ouhfbhqkld erke jhheihje idndkd kje poersfw ldjhgf
ajdfolj ifuj kjbndfj ‘ihfibjf f’drfk;nbj

Seems like on 1st instance, however i think this kind may have a possible way of differences between similar kinds?
Yes?
Check this, compare the above with this one:
k;jhsf ;kjbhf kjf kuhjfs kjhf
kjhdfkjbgf jgf jhdfkidf kjhfd jsd
prhgj jhdf kf kjnbjnhhjkdf jfkj
tnkf lkjhfol qpof kjlkjklk eyiioli

I see.. 5 elements on each line..
Yes..
Or:
eueueueueueue cmcmcmcmcmcmc
slslslslslsll mqmqmqmqmqmmq

Yes..
and:
vpvpvpvpv
qvqvqvqvqvqvqvqvqv
pbpbpbpbpbpbpbpbpbpbpbpbpbpbpbppbp
qbqbqbqbqbqbqbqbqbqbqbqbqbqbqbqbqbqbqbqbqbqbqbqbqbqbq

which could come different to something like:
pvpvpvpvpv
qvqvqvqvqvqvqvqvqvq
bpbpbpbpbpbpbpbpbpbpbpbpbpbpbppbppb
bqbqbqbqbqbqbqbqbqbqbqbqbqbqbqbqbqbqbqbqbqbqbqbqbqbqb

Yes.. And such patterns can be much easier to read at the same time.
Yes.. And such patterns can come as a sensational abstract background for whoever encounters them.
Yes.. And.. However – will a code read these differently to:
Bum/Blind/Ping/Move/Play/Drone/Dude/Gun/Boon/Lush/Ground

Yes!
No!
Nope!
Never!
Yup!
Hooray!
Yey!
Naa!
Nono!
Yeepers!
or
Both yes and no at the same time!
or
maybe
or
maybe/yes/no/or/and/else

..and where electric pulses move to when their background is full of:
qpqpqpqpqpqpqpqpqpqpqpqpqpqpqp—pwpwpwpwppwpwpwpwpwp
alalalalalalalalalalalalalalal—kakakakakakakakakaka
mzmzmzmzmzmzmzmzmzmzmzmzmzmmzm—xmxmxmxmxmxmxmxmxmxm

I don’t know about electric pulses, however, for me, a zenny feeling of a rather poo full crazy xmass!!!
Oh! That’s what you think it Means, that’s what you think the background Means – not how you allow it to take you so it remains in the background!
No?
No!
No??
How do you know??
kaka?/lala?xmxm..?
oh! associations rather than meanings!
Could be indeed. yet – that’s a bit of a difficulty with this such kind and kynds of backgrounds no?
How?
These backgrounds do not necessarily Operate as backgrounds in reading. They can come into a foreground, in a focus that places something else into the background
Something that points towards themselves possibly neither background or any other thing. A reading mind may put them in the background or not – and they may still operate very well.
In other words?
we get a theatrical background rather than something that to live, to be alive, to evolve – has to operate textually background. Something that needs to be Yanked out of the background and will always get back there?

A background exit?
A background escape?
A theatre? What’s the play?
In computer games we get backgrounds that play visually. Backgrounds, in fact, are codes that generate visible stuff that plays the effect of, for example, a background for something else that’s in focus. Elements from such backgrounds could come into focus and turn out of the distance of fuzziness into something clear, near and in the foreground.
Anything wrong with such backgrounds?
Background reading akin to something like a game could come as a description of an atmosphere. A thinly racketed warm layers of sun rays interlaces with memories from sounds of passing vehicles who’s movements rattles dust into dancing and a faint brown scent from drying cardboard boxes wooshes through the room’s floor crevices and into lungs aching for gasps of oxygen while time glows shorter between each breathing sound.
Here, we can have a certain notion of an environment that may be a context for someone asking how come the ambulance takes so long.
Yet, the background could pop into foreground when, for example, we get a breaking in the thin layers of sun rays, a breaking gains a voice which seems to direct movements inside the environment. A sun rays voice that comes hopeful in its exemplary helplessness and that through that very connection between an indifferent cosmos, life on earth and assistance, we can get a focus, a foreground that may indeed, place the entrance of the medics into a background.

How about backgrounds in music? We could have some background sounds and beats. Yes. We could have something like that in text as well.. Some kind of an over elaborated text that describes a movement that’s never existed but sort of kinda possibly had a bit of a faintly registered allusion to having once a visit from a witness who thought or imagined or noticed or something like that – or another – a movement of plausibly something thin like a hair or a hairy shadow, or some kind of thin dark thread on an otherwise thinly lined floor that, if you looked closely, could seem to stretch for miles on end but was really in a rather isolated forgotten and inhabited clean closed room our witness is supposed to have helped themselves into.

It seems that perhaps we can imagine background texts in many other ways. Radically different ways?
Hold on.. Isn’t this – an “about” text is an offering of an instant background text reading?
We could yes, say that we could yes yet, hummm.. yes.. no.. oh.. perhaps we get a different theatre here, but still it’s not in and of itself a background that HAS to remain in the background so they could live.
It’s a matter of choice rather than evolving lives.
The absoluteness of the text has a context dependency, that which the text is about. We read about the background, however to bring this text to life, we put it in various focused foreground.

Perhaps there isn’t any faint possibility to have a background text that lives, as you say, from the very oxygen of backgroundness.
Perhaps text-backgrounding comes as a desire, a wish that, to live – may never come to pass? Perhaps indeed. yet I wonder, something here seems missing a way. something here seems to have a bend, a bias towards text that perhaps places a few closed blinds that inhibit the way to examine texts into background reading them?
Any clue wtf are you on about – apart from perhapses that could encompass almost a whole cosmic scaled bullshit?
Yes.
Yes?
Yeha!
Yup?
Well..
Lets..
Lets?
Try this thing, this text.
CATACTTCATCGGTCCACTGTGATCTCTAC
huh?
Well..
When we read CATACTTCATCGGTCCACTGTGATCTCTAC – a dna sequence, don’t we get something that, to live, has to come as readable in the background of stuff?
Code is an spontaneous background readable text?
Let’s try to go with this a bit..
Code with lively coded music, say algoraves…
Yes – algoraves generation!
We read the code?
Yes.
Code generates sounds?
..or could generate other stuff.
Yes – algoLit!
Yeha – algoDance!
Sure – algoTheatre!
Woha – algoGarage!
Yup – algoClinic!
Yo – algoCinema!
..and when we read the text, that reading (and writing) lives in the background?

Sure. However.. Yes.. That’s a very functional text that in and of itself, like the CATACTTCATCGGTCCACTGTGATCTCTAC code without its consequences – isn’t very interesting in and of itself as something in the background..
Hold on here..
So we want something in the background that lives from and through that very backgroundness and yet comes as something interesting rather than simply away from whatever comes in the foreground.
Yes.
What’s not interesting in a code that generated a fab music..?
or a bloody good clinic!
or a dance!
and a theatre!
or fixes vehicles in a garage!
or cinema!
and fantastic literature?

Indeed – how could such a code come as not interesting?
Yet, it seems curiosity and interest has other elements, other aspects perhaps, other ways to come which backgrounds could offer a reading with and that may live.
What?
How?

OK..
Here perhaps we want to consider stuff like grammatical elements.
For example:
suffixes and prefixes…
Hyper-ventilating windNess?
Sure, lets check things like:
Hyper-
Super-
Hydro-
-Ous
-Ity
-Ness

a text containing a list of such terms,
can it live outside of a background?
Even when we use, when the terms come to get into their own they add backgrounds to the attached terms. Like a space based background, they orient terms precisely by living in the backgrounds. Indeed, they can do that by having a fragmented nature, they are spontaneously fragmented.
Their wholeness comes and lives as bits?
Are they not limited and rather less than interesting? Hyper-this, hydro-that, bio-such-n-such.. Yes.
Curious though to note that camouflage, visuals that are made to appear in a background – even if they are not – are fragmented as well. Think army uniform..
See, like fragmented clothing, perhaps we can make text that is fragmented?
For example:
Instead of
Hyper-ventilating windNess cosmetics.
we could say something very different using gnashing sounds and wine flavour.
Gnasho-ventilating windWineflav
Would it not be better as:
Gnasho-ventilating windFlaviwine?
why?
The flavour can alter easier?
Falvichoco
Flavicoffee
flavignash
hummm.. curious.. so we get sorta double barrel suffixes?
We already do ItyNess in english..
Like Sweetyness?
and
Sweatyness?
So..
So?
Well.. a fair bit of work ahead, no?
Ahead into the background?
Yay!

Yay?

Yay..?

Not so soon nor fast – since here we offer a plausible mistaken direction of meaning.
Don’t do me meanings now?
Let’s’ not indeed, just note that the background made from Ity + Ness is a beginning of an example for a background text –
not the background text itself?
Are we saying that the background text is not stuff like ity + ness?
not pre+su+fix?

Let us remain with aesthetics in its very naive and instinctive manner of visual sensations.
Lets!
Cool. Now.. Lets take that kind of aesthetics and consider backgrounds. One of the visual material tonality of backgrounds, as we mentioned before, comes from them being fuzzy. A clear background appears somehow fuzzy. We can contrast that with, for example, perspective oriented paintings, when stuff behind a figure/object in the front – can still come clear as to what it is. A mirror, a fruit, a tree, a person, and so on. These are simply elements that offer a confabulation of 3 dimentionality.
When we shoot a photo and are able to designate elements within a shape – usually a rectangle – to come in focus, the background, like ones in paintings, comes with a distinct and markable fuzzyness. The background is clearly less clear than other elements – even when spatially – in terms of composition in space – the element is nearer the “front”.
When we say that a background text which lives as a background – rather than performs a theatrical background-like gesture, a performativity this very text does –
we need to focus on texts that, when come into living, daily lives thinking, speaking, writing and such like; remain in the background. Yet, since writing – or any other manner of sharing – has it’s own focus, own special imprint marking signature, it seems we can hardly get away by simply listing stuff like affix types and claim them to come as background text for reading in background.
No?
NO?
Oh no..
No no no and..
no?
Yes!
However, after all that text about the insufficiwency of stuff like writing lists of affixes – what may live sufficienty?
Ah!
Ha!
Oh!
WTF?
Yes.. You see, we have a new world here in a way that everybody knows any utterance – even oh! Ha! Ah! And such exclamation sounds – can come as affixes.
We can eat
OhBread
and contrast it with
BreadOh
with AhBread in the middle?
(In case this sounds like too many pieces of bread for something like a sandwich, lets’ not that there are cultures who do have sandwiches made from mixing kinds of bread like pittabread with ryebread and so on..)
How about SandBread?
How about SandBreadOh?
How about SandwichHa?
Where’s the bread?
The bread has gone and now we can ask how we get a background?

(we have a question of overall lingo structure and expectations – what are exclamations ((sounds)) and why do we need in imagination?) supplement has something to do with the thing it supplements. Backgrounds don’t – hence we can have infect as a contamination and make an HaFect as something very different that needs not the infect..?
no..
hafect
blahFect
duhFect
– as a type in which the background is contaminated by infections.
We can then move to other types from the exclaing sounds into questioning:
huhFect
eyFect
or to moving sounds suffixes like
FectWoosh
FectWeee
etc.